Predicting 2D structure of RNA by genetic algorithm. Example

GArna: Predicting 2D structure of RNA by genetic algorithm

Example sequence: rat Phe tRNA (the entry DF5280 in the database accumulating tRNA sequences):

If your sequence exceeds 250 nt please use MatrixSS program

Input RNA sequence :
GTTAATGTAGCTTATAATAAAGCAAAGCACTGAAAATGCTTAGATGGATTCAAAAATCCCATAAACA
Stop calculation when population degeneracy D exceeds ( 0 < D < 1 )
Minimal helix length: nucleotides
Selection temperature: kkal/mol
Randomization parameter:
Positions covered by oligonucleotide, from: to:
About

This resource was developed at the Institute of Cytology and Genetics, SB RAS, Novosibirsk, Russia

Author: Igor I. Titov
Contributors: Denis G. Vorobiev, Vladimir A. Ivanisenko, Nikolay A. Kolchanov